Query (optional)   in Class  

GrainGenes Probe Report: MWG949

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG949  [ Marker Report ]
Locus
MWG949
[ Show all 6 ]
Synonym
SynonymHAR35_19354
General Remarks
MWG949 comes from a digest of MWG950 plasmid DNA and excising the 1.8 kb fragment.
Type
Genomic
STS
STS primers
5' CGGCTGGTAAATGAACTGAA
5' GGCTTCCGCTACTACGTCTT
STS size
ca. 1800
Amplification Conditions
STS annealing temperature 52-55 oC
Sequence
AJ234667
AJ234666
MWG949-5
MWG949-3
Linkage Group
2
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.8
Clone Vector
Bluescript
pBS
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03