Query (optional)   in Class  

GrainGenes Probe Report: NAR1

Probe
NAR1  [ Marker Report ]
Locus
Nar1
General Remarks
NADH nitrate reductase
Type
Genomic
STS
PCR primers
ATGTCCTCCGTCACAAACCC
AGTACTTCCGTCCATGCTCG
Specificity
Does not map at Steptoe x Morex locus Nar1
Linkage Group
6S
Source Species
Hordeum vulgare
Insert Size
3
Clone Vector
pBS
Excision Enzyme
EcoRI
DraI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Blake, Tom93.04.09
ATMI92.09