Query (optional)   in Class  

GrainGenes Probe Report: PSP3000

[ Printable Version ]  [ Submit comment/correction ]

Probe
PSP3000  [ Marker Report ]
Locus
Xpsp3000-1B
Xpsp3000-1B (Gli B1)
Yr10
Xpsp3000
Reference
ReferenceStephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
ReferenceBryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
Type
PCR
SSR
PCR primers
Forward GCAGACCTGTGTCATTGGTC
Reverse GATATAGTGGCAGCAGGATACG
SSR size
286, 1B locus
Amplification Conditions
55C anneal
Source Species
Triticum aestivum
Data Source
Stephenson, Pauline2006.04