Query (optional)   in Class  

GrainGenes Probe Report: PSP3123

[ Printable Version ]  [ Submit comment/correction ]

Probe
PSP3123  [ Marker Report ]
Locus
Xpsp3123-7D
Xpsp3123
Reference
ReferenceStephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
ReferenceBryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
General Remarks
Insert contains repeat (TC)16
Type
PCR
SSR
PCR primers
Forward AGATTAGATGGCATAAGCAAAGAGC
Reverse GATTAATCACCGCCCTTGGTCC
SSR size
178, 7D locus
Amplification Conditions
63C anneal
Sequence
PSP3123
Source Species
Triticum aestivum
Clone Location
Gale, Michael D.
Data Source
Stephenson, Pauline2006.04