Query (optional)   in Class  

GrainGenes Probe Report: PSR128

[ Printable Version ]  [ Submit comment/correction ]

Probe
PSR128  [ Marker Report ]
Locus
Xpsr128
[ Show all 8 ]
Synonym
SynonymHAR35_14265
HAR35_33772
General Remarks
Polymorphism scores are given as the percent polymorphic pairwise comparisons, followed by the number of alleles found and number of varieties tested in parentheses.
Type
cDNA
STS
PCR primers
TGCCATGTTTAGAATAACACGC
AGAACAAGGAGAAGGAGCTCG
Sequence
PSR128
Copy Number
1
Background
3
Cross hybridizes to
Secale cerealegood
Hordeum vulgaregood
Polymorphism
PSR128 H DraI0.0 (1, 4)
[ Show all 19 ]
Gel
PSR128 Gale
Linkage Group
5AL
5BL
5DL
5R
5L
Insert Enzyme
SmaI
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Source Tissue
Leaf
Insert Size
0.56
Clone Vector
pUC18
Vector Enzyme
SmaI
Excision Enzyme
HindIII
EcoRI
Vector PCR primers
5'-d(GTTTTCCCAGTCACGAC)-3'
5'-d(CAGGAAACAGCTATGAC)-3'
Clone Location
Gale, Michael D.
Clone Authority
Chao, Shiaoman
Blake, Tom
Data Source
Gale, Michael D.97.09
Blake, Tom95.08.24
ATMI92.09
Gill, Bikram S.92.09