Query (optional)   in Class  

GrainGenes Probe Report: Rht-B1_SNP

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Rht-B1_SNP
Reference
ReferenceRasheed A et al. (2016) Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics 129:1843-60.
General Remarks
FAM = wild type
HEX = dwarf
Type
KASP
PCR primers
FAM 5' CCCATGGCCATCTCCAGCTG
HEX 5' CCCATGGCCATCTCCAGCTA
Common Reverse TCGGGTACAAGGTGCGGGCG
Source Gene
Rht-B1 (Triticum)
Source Allele
Rht-B1a (Triticum)
[ Show all 8 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.