Query (optional)   in Class  

GrainGenes Probe Report: SCMIOI

[ Printable Version ]  [ Submit comment/correction ]

Probe
SCMIOI
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
General Remarks
Contains repeat (CT)18
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php14
Type
PCR
SSR
PCR primers
5' GCCAGCCGCCACCTTAATTG
3' AGCCCAACTCTTTCGTGCATG
SSR size
170
Amplification Conditions
Annealing temperature = 60 degrees C
Source Species
Secale cereale