Query (optional)   in Class  

GrainGenes Probe Report: SDAUK130

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
SDAUK130
Locus
XsdauK130
Reference
ReferenceWang H et al. (2020) Horizontal gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat Science 09Apr2020.
Type
PCR
PCR primers
Forward primer TCACACAACCTGCATTGGAT
Reverse primer ATGCCATACGCATTTCCAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.