Query (optional)   in Class  

GrainGenes Probe Report: Stars760

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars760
Locus
Stars760
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR = (TA)24
Product Size = 394 bp
Genomic location = 546, 426, 757 - 546, 427, 150
Type
SSR
PCR primers
Forward 5' TCACGCTTAGAATAGCGTTACC
Referse 5' GTTTACCCGCTTGTTTCTGC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.