Query (optional)   in Class  

GrainGenes Probe Report: Stars762

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars762
Locus
Stars762
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (AG)16
Product size = 397 bp
Position = 565, 757, 790 - 565, 758, 186
Type
SSR
PCR primers
Forward 5' GGGGCAAGGCTCATGTATT
Reverse 5' CTTGGCTAAGCTTGCAGTCC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.