Query (optional)   in Class  

GrainGenes Probe Report: Stars764

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars764
Locus
Stars764
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (CAT)5 + (TC)7 + (AC)6 + (TC)5
Product size = 298 bp
Position = 589, 831, 646 - 589, 831, 943
Type
SSR
PCR primers
Forward 5' AACCAAATGGCACACCTCTC
Reverse 5' ATCTACTCCGCCTCCATGTG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.