Query (optional)   in Class  

GrainGenes Probe Report: Stars767

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars767
Locus
Stars767
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (TG)10 + (AG)14
Product size = 358 bp
Position = 611, 837, 791 - 611, 838, 148
Type
SSR
PCR primers
Forward 5' TTGCATCCTCTTCTCCCAGT
Reverse 5' GTCGCCGGGTAAATCTATCA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.