Query (optional)   in Class  

GrainGenes Probe Report: Stars800

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars800
Locus
Stars800
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (GA)19
Product size = 388 bp
Position = 648, 668, 273 - 648, 668, 660
Type
SSR
PCR primers
Forward 5' TCAGTGAACACCACGGAGAG
Reverse 5' TCTAGGGACGGTGTGGAGAC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.