Query (optional)   in Class  

GrainGenes Probe Report: Stars804

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars804
Locus
Stars804
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (TG)17 + (CGTG)5
Product size = 342 bp
Position = 658, 940, 748 - 658, 941, 089
Type
SSR
PCR primers
Forward 5' CCAGAGCCCTAGCAGAAGTG
Reverse 5' AAACGTCGCCATGCTAAAA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.