Query (optional)   in Class  

GrainGenes Probe Report: Stars805

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars805
Locus
Stars805
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (AG)10 + (TG)6
Product size = 131 bp
Position = 662, 732, 666 - 662, 732, 796
Type
SSR
PCR primers
Forward 5' CGGGAGTACGCGATACATTT
Reverse 5' GCGTCGCCTCCATCTACTAC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.