Query (optional)   in Class  

GrainGenes Probe Report: Stars809

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars809
Locus
Stars809
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (TTA)20
Product size = 378 bp
Position = 730, 401, 992 - 730, 402, 369
Type
SSR
PCR primers
Forward 5' CAGCTTTCCTAGGGCCTCTT
Reverse 5' ATTACCTGGACGGAGGGAGT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.