Query (optional)   in Class  

GrainGenes Probe Report: Stars811

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars811
Locus
Stars811
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (TA)36
Product size = 344 bp
Position = 734, 516, 232 - 734, 516, 575
Type
SSR
PCR primers
Forward 5' TGCAGGACACAACAGACTCC
Reverse 5' CCGGAGCGTAGGATAGAACA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.