Query (optional)   in Class  

GrainGenes Probe Report: Stars813

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars813
Locus
Stars813
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (AT)32
Product size = 258 bp
Position = 736, 435, 268 - 736, 435, 525
Type
SSR
PCR primers
Forward 5' AAGCCAATGATGCTGTACCC
Reverse 5' TGATGATTGCGGTACGTGTT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.