Query (optional)   in Class  

GrainGenes Probe Report: Stars814

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Stars814
Locus
Stars814
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
SSR repeat = (TA)25
Product size = 278 bp
Position = 736, 544, 266 - 736, 544, 543
Type
SSR
PCR primers
Forward 5' AACGCTTCAGAATCCATTGC
Reverse 5' CATGCAAAAGGGAGGAGAAA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.