Query (optional)   in Class  

GrainGenes Probe Report: TNP-33

[ Printable Version ]  [ Submit comment/correction ]

Probe
TNP-33  [ Marker Report ]
Locus
DsT-33
General Remarks
Primers amplify in OWBs and Golden Promise
Type
PCR
STS
PCR primers
TNP-33-24F 5' GCACACATATTATCATGAAAAAGAGC
TNP-33-348R 5' ACCCCAAATGAGTTTCGATG
Source Species
Hordeum vulgare