Query (optional)   in Class  

GrainGenes Probe Report: TaMoc-2433

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
TaMoc-2433
Locus
TaMoc-A1
Reference
ReferenceUr Rehman S et al. (2021) Development and Exploitation of KASP Assays for Genes Underpinning Drought Tolerance Among Wheat Cultivars From Pakistan. Frontiers in Genetics 12.
ReferenceRasheed A et al. (2016) Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics 129:1843-60.
General Remarks
FAM = Hap-H
HEX = Hap-L
Type
KASP
PCR primers
FAM 5' CGGAAAGCTTAGAAATGCACGG
[ Show all 6 ]
Source Gene
TaMoc-A1 (Triticum)
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.