Query (optional)   in Class  

GrainGenes Probe Report: TaPPH-KASP-13

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
TaPPH-KASP-13
Locus
TaPPH-7A
Reference
ReferenceUr Rehman S et al. (2021) Development and Exploitation of KASP Assays for Genes Underpinning Drought Tolerance Among Wheat Cultivars From Pakistan. Frontiers in Genetics 12.
Type
KASP
PCR primers
FAM primer 5'GTTGTAAGACTGACATAACAATC
HEX primer 5'GTTGTAAGACTGACATAACAATT
Common primer 5' GCTGGCTGTAAATGTTAATGTGTCTCC
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.