Query (optional)   in Class  

GrainGenes Probe Report: UMB201

[ Printable Version ]  [ Submit comment/correction ]

Probe
UMB201  [ Marker Report ]
Locus
UMB201
Reference
ReferenceBeaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
General Remarks
See reference for PCR and amplification conditions
Type
SSR
PCR primers
GCTCCTGAAAAGGACCTCAG
TCTCCGCCACCTACACATAG
Sequence
BJ480735