Query (optional)   in Class  

GrainGenes Probe Report: WBE208

[ Printable Version ]  [ Submit comment/correction ]

Probe
WBE208  [ Marker Report ]
Locus
WBE208
Reference
ReferenceMarcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type
PCR
PCR primers
5' acgtcgtcgagtggttgatgtg 3'
5' agttttggcgtggtccttttg 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare