Query (optional)   in Class  

GrainGenes Probe Report: WMC469

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMC469  [ Marker Report ]
Locus
Xwmc469
[ Show all 6 ]
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 1, Plate reference 21h12
Donor: Dupont
Location from nullisomic/tetrasomic (Daryl Somers, AgCanada, Feb 2001) : 150 bases located on 1A
Trimmed to insert at both ends. (CT)13 93 to 118, (CT)27 120 to 173.
Type
PCR
SSR
PCR primers
Forward aggtggctgccaacg at 45 length 15 bases, Tm 60
Reverse caattttatcagatgcccga at 173 length 20 bases, Tm 60
SSR size
148 bases expected, Chinese Spring
Amplification Conditions
51C anneal, polymorphic on acrylamide (polymorphism 120-148 and many other bands).
Sequence
WMC469
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.06
Isaac, Peter G.2004.06