Query (optional)   in Class  

GrainGenes Probe Report: WMC606

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
WMC606  [ Marker Report ]
Locus
Xwmc606-7B
[ Show all 6 ]
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward CCGATGAACAGACTCGACAAGG
Reverse GGCTTCGGCCAGTAGTACAGGA
SSR size
190 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.