Query (optional)   in Class  

GrainGenes Probe Report: WMC720

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMC720  [ Marker Report ]
Locus
Xwmc720-4D
wmc720-4D
WMC720
wmc720
Xwmc720
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward CACCATGGTTGGCAAGAGA
Reverse CTGGTGATACTGCCGTGACA
SSR size
117 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07