Query (optional)   in Class  

GrainGenes Probe Report: WMC770

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMC770  [ Marker Report ]
Locus
Xwmc770-2B
wmc770
wmc770-2B
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward TGTCAGACTTCCTTTGATCCCC
Reverse AAGACCATGTGACGTCCAGC
SSR size
135 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07