Query (optional)   in Class  

GrainGenes Probe Report: WMS132

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMS132  [ Marker Report ]
Locus
Xgwm132-6B
[ Show all 18 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)24(GAA)6imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TACCAAATCGAAACACATCAGG 3'
5' CATATCAAGGTCTCCTTCCCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS132
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15