Query (optional)   in Class  

GrainGenes Probe Report: WMS570

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMS570  [ Marker Report ]
Locus
Xgwm570-6A
Xgwm570
Sr52
gwm570
gwm570-6A
Reference
ReferenceQi LL et al. (2011) A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat Theoretical and Applied Genetics 123:159-167.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. Sr52 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Insert contains repeat (CT)14(GT)18
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCGCCTTTTACAGTCGGC 3'
5' ATGGGTAGCTGAGAGCCAAA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS570
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15