Query (optional)   in Class  

GrainGenes Probe Report: WMS6

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMS6  [ Marker Report ]
Locus
Xgwm6.1-4B
[ Show all 18 ]
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceFu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks
Insert contains repeat (GA)40
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (GA)x40.
Product size 205 bp in Cheyenne.
In 369 Avena sterilis accessions there were 3 alleles of size 48-60 bp, PIC = negative.
Type
Genomic
PCR
SSR
PCR primers
5' CGTATCACCTCCTAGCTAAACTAG 3'
5' AGCCTTATCATGACCCTACCTT 3'
CGTATCACCTCCTAGCTAAACTAG
AGCCTTATCATGACCCTACCTT
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS6
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17
Fu, Yong-Bi2007.04