Query (optional)   in Class  

GrainGenes Probe Report: af166121

Probe
af166121  [ Marker Report ]
Locus
AF166121A
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceCardle L et al. (2000) Computational and experimental characterization of physically clustered simple sequence repeats in plants Genetics 156:847-854.
Type
SSR
PCR primers
TTATGCTTCACACGGTGTAC
GGCACAAAAAGACTGAAATAG