Query (optional)   in Class  

GrainGenes Probe Report: baak11d04

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak11d04  [ Marker Report ]
Locus
k00002
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = Oxalate oxidase 2 precursor (Germin) gb AAA20245.1 germin subunit
Type
PCR
PCR primers
Left 5' - CATGCGGGAATCGATAATCT
Right 5' - TTCCCTTATTCCAAATCCCC
Sequence
AV910875
PCR size
423