Query (optional)   in Class  

GrainGenes Probe Report: baak11h14

Probe
baak11h14  [ Marker Report ]
Locus
k00074
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = OSJNBb0085F13.6 [Oryza sativa (japonica cultivar-group)] emb CAE04613.2 OSJNBb0004G23.11 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - ACCTTTCTGCCAACCTAGCA
Right 5' - AACCTCAAGGCAAAAAGGGT
Sequence
AV910952
PCR size
366