Query (optional)   in Class  

GrainGenes Probe Report: baak11j13

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak11j13  [ Marker Report ]
Locus
k00086
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = probable transcription repressor HOTR - barley emb CAA04677.1 putative transcription repressor HOTR [Hordeum vulgare subsp.
Type
PCR
PCR primers
Left 5' - GACACGGCAGCAAACAAGTA
Right 5' - CGGTAAGACAGAGCCGCTAC
Sequence
AV910983
PCR size
366