Query (optional)   in Class  

GrainGenes Probe Report: baak12d02

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12d02  [ Marker Report ]
Locus
k00017
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = rubisco expression protein -related [Arabidopsis thaliana] gb AAK28639.1 putative rubisco expression protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - CCAGACTGACGATTTGGGAT
Right 5' - GTGAAGCAATTCATGCAAGC
Sequence
AV911144
PCR size
389