Query (optional)   in Class  

GrainGenes Probe Report: baak12f01

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12f01  [ Marker Report ]
Locus
k00077
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (Sedoheptulose-bisphosphatase) (SBPASE) (SED(1,7)P2ASE)
Type
PCR
PCR primers
Left 5' - ACCATCTTCTCCACCCAGTG
Right 5' - TACTTCAGCACCGTCTTCCC
Sequence
AV909893
PCR size
418