Query (optional)   in Class  

GrainGenes Probe Report: baak12f13

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12f13  [ Marker Report ]
Locus
k00006
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = ribose 5-phosphate isomerase-related [Arabidopsis thaliana] dbj BAB09159.1 unnamed protein product [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - ATAGGCAGAGAGACCAGGCA
Right 5' - ACGATACTTGGGGAAAGCCT
Sequence
BJ456216
PCR size
427