Query (optional)   in Class  

GrainGenes Probe Report: baak12j16

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12j16  [ Marker Report ]
Locus
k00078
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = P0019D06.29 [Oryza sativa (japonica cultivar-group)] dbj BAB16470.1 P0019D06.29 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - TACTAGGGTGGTTGCCTTGG
Right 5' - TCCAGACAGACATCAGCGAC
Sequence
AV911267
PCR size
455