Query (optional)   in Class  

GrainGenes Probe Report: baak13c05

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak13c05  [ Marker Report ]
Locus
k00056
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = P0435B05.23 [Oryza sativa (japonica cultivar-group)] dbj BAB89544.1 P0435B05.23 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - GAAGCGAATACAGAGGACCG
Right 5' - GCTGCTCATGGTGCTACAAA
Sequence
AV911420
PCR size
403