Query (optional)   in Class  

GrainGenes Probe Report: baak13j10

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak13j10  [ Marker Report ]
Locus
k00046
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = SNF8 like protein [Arabidopsis thaliana] pir T04827 SNF8 protein homolog F10M23.380 - Arabidopsis thaliana
Type
PCR
PCR primers
Left 5' - TTGCATTGAAGCTCGACAAC
Right 5' - ACCAGTTCTGGATTATGCGG
Sequence
AV911568
PCR size
403