Query (optional)   in Class  

GrainGenes Probe Report: baak13n06

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak13n06  [ Marker Report ]
Locus
k00070
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Type
PCR
PCR primers
Left 5' - TCCTTCAGAGGCGAACCTAA
Right 5' - GACCAAGATAAGCGCGAAAG
Sequence
AV911643
PCR size
414