Query (optional)   in Class  

GrainGenes Probe Report: baak14c12

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak14c12  [ Marker Report ]
Locus
k00072
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = expressed protein [Arabidopsis thaliana] gb AAK91458.1 AT4g15470/dl3775w [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - TGGGCTCATAGCAAAGAGGT
Right 5' - AGCAGAAGTCTCAAGCTGCC
Sequence
BJ454627
PCR size
491