Query (optional)   in Class  

GrainGenes Probe Report: baak16a11

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak16a11  [ Marker Report ]
Locus
k00102
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = iron/ascorbate-dependent oxidoreductase [Hordeum vulgare]
Type
PCR
PCR primers
Left 5' - TTCAGTGGGATTCTGTTCCC
Right 5' - CGATTCCGTAGTACCCCTCA
Sequence
BJ455267
PCR size
374