Query (optional)   in Class  

GrainGenes Probe Report: baak16e08

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak16e08  [ Marker Report ]
Locus
k00126
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = anon1A3 [Drosophila simulans]
Type
PCR
PCR primers
Left 5' - CTCGTCGCTCTCCTTTGAAC
Right 5' - CCTATGGTGCTCAAGTCCGT
Sequence
BQ663710
PCR size
446