Query (optional)   in Class  

GrainGenes Probe Report: baak18g16

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak18g16  [ Marker Report ]
Locus
k00108
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = OSJNBa0009K15.15 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - AATGACTGGAGCTGGAGGTG
Right 5' - TCCTGGCACTCTCACAAAGA
Sequence
BJ455816
PCR size
386