Query (optional)   in Class  

GrainGenes Probe Report: bah55e06

[ Printable Version ]  [ Submit comment/correction ]

Probe
bah55e06  [ Marker Report ]
Locus
k04435
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = TGF beta receptor associated protein-related [Arabidopsis thaliana] pir E86362 hypothetical protein F19G10.18 - Arabidopsis thaliana
Type
PCR
PCR primers
Left 5' - TTTCTGTAATCCACCCAGCC
Right 5' - CTCGCCTTACCGTGGAGATA
Sequence
BJ485319
PCR size
364