Query (optional)   in Class  

GrainGenes Probe Report: cMWG652

[ Printable Version ]  [ Submit comment/correction ]

Probe
cMWG652  [ Marker Report ]
Locus
Xcmwg652-6
[ Show all 19 ]
Reference
ReferenceAbu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
ReferenceKunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks
Restriction enzyme informative in CAP analysis is HaeIII
Type
cDNA
STS
STS primers
5' GAGCTGCTCGTTCTCGTTGA
5' CACACCTTCTTCTTCCTCTT
STS size
417
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234405
AJ234404
CMWG652-5
CMWG652-3
Linkage Group
6H
6
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
1
Clone Vector
Bluescript
pBluescr.
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Stein, Nils2006.10
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03