Query (optional)   in Class  

GrainGenes Probe Report: cMWG663

[ Printable Version ]  [ Submit comment/correction ]

Probe
cMWG663  [ Marker Report ]
Locus
Xcmwg663-2
cMWG663
cMWG663A
cMWG663B
cMWG663-2H
Synonym
SynonymHAR35_10087
HAR35_16744
HAR35_41390
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' GAGGATGACAACGTCTCAGC
5' AAGCACCAGAATTAGCCTGG
STS size
451
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234411
AJ234410
CMWG663-5
CMWG663-3
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Clone Vector
Bluescript
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Stein, Nils2006.10
Kuenzel, Gottfried00.03