Query (optional)   in Class  

GrainGenes Probe Report: cMWG706

[ Printable Version ]  [ Submit comment/correction ]

Probe
cMWG706  [ Marker Report ]
Locus
cMWG706A
[ Show all 7 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' GGGCAAGACTGTGCTGGAGC
5' CCAGTGGATTTGTACTGCAC
STS size
ca. 1200
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234432
CMWG706-5
Linkage Group
1H
Barley 1 (7H)
Barley 5 (1H)
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
0.75
0.8
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Stein, Nils2006.10
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03